View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918-Insertion-7 (Length: 120)
Name: NF2918-Insertion-7
Description: NF2918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918-Insertion-7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 4591114 - 4591226
Alignment:
| Q |
8 |
atttattaatcaatcaacacaattcttcaaaatatcagaaattttaatggaaataaaataaaaattagaatttcaccttctgttcgatttcaggaacctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4591114 |
atttattaatcaatcaacacaattcttcaaaatatcagaaattttaatggaaataaaataaaaattagaatttcaccttctgttcgatttcaggaacctt |
4591213 |
T |
 |
| Q |
108 |
aagcaccttcaga |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4591214 |
aagcaccttcaga |
4591226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University