View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918-Insertion-8 (Length: 108)
Name: NF2918-Insertion-8
Description: NF2918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918-Insertion-8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 5294684 - 5294583
Alignment:
| Q |
7 |
agctagcacattgttgctattcatttatcatgattcatcaattattggccacaaatctatgttttgtctgattgtaatccatatcatttttattggttct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5294684 |
agctagcacattgttgctattcatttatcatgattcatcaattattggccacaaatctatgttttgtctgattgtaatccatatcatttttattggttct |
5294585 |
T |
|
| Q |
107 |
tg |
108 |
Q |
| |
|
|| |
|
|
| T |
5294584 |
tg |
5294583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University