View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918R-Insertion-16 (Length: 78)
Name: NF2918R-Insertion-16
Description: NF2918R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918R-Insertion-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 5e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 7 - 78
Target Start/End: Original strand, 2080292 - 2080363
Alignment:
| Q |
7 |
caataatatcactgctctgaatgaacttcattttttgtctgcacatatacaatggtccattttcactgcttc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2080292 |
caataatatcactgctctgaatgaacttcattttttgtctgcacatatataatggtccattttcactgcttc |
2080363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University