View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918R-Insertion-6 (Length: 711)
Name: NF2918R-Insertion-6
Description: NF2918R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918R-Insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 1e-80
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 11040223 - 11040018
Alignment:
| Q |
8 |
agcaatgagatagtaacttgtgacacaagtcttctgatatcagaaaatctttgctccagagattcaagcttccagttaaa------------ctcagaaa |
95 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11040223 |
agcaatgggatagtaacttgtgacacaagtcttctgatatcaggaaatctttgctccagagattcaagcttccagttaaaattttcaatatactcagaaa |
11040124 |
T |
|
| Q |
96 |
ttgtgtagtcctcaatcatatcagttgtgacatttagggatttaatcaatgaatcaccacaccagttatcaaaccaaaaactgatatgttgtccattccc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11040123 |
ctgtgtagtcctcaatcatatcagttgtgacatttagggatttaatcaatgaatcaccacaccagttatcaaaccaaaaactgatatgttgtccattccc |
11040024 |
T |
|
| Q |
196 |
cagcaa |
201 |
Q |
| |
|
|||||| |
|
|
| T |
11040023 |
cagcaa |
11040018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University