View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918_high_14 (Length: 238)
Name: NF2918_high_14
Description: NF2918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 23776592 - 23776378
Alignment:
| Q |
1 |
cctgttcgatttcagtcaatcaattgttttcgttagtaatcaaacaacttcttagcacacgtaagttccttcattcggtggagtgcatgtgtctaaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23776592 |
cctgttcgatttcagtcaatcaattgttttcgttagtaatcaaacaacttcttagcacaagttagttccttcattcggtggagtgcatgtgtctaaaatt |
23776493 |
T |
|
| Q |
101 |
taattacgtttctatgttacgtgggtgttcttctattggtgtaagtttcaattattaggtgctctttgatttgttttggtgtttcaactaaatattaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23776492 |
taattacgtttctatgttacgtgggtgttcttctattggtgtaagtttcaattattaggtgctctatgatttgttttggtgtttcaactaaatattaaaa |
23776393 |
T |
|
| Q |
201 |
gttctcacatattct |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23776392 |
gttctcacatattct |
23776378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University