View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918_high_5 (Length: 304)
Name: NF2918_high_5
Description: NF2918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 37922265 - 37922123
Alignment:
| Q |
18 |
gttcttacctctcttttcaatttttcataggcttgtttattatgattgttttggttatggacatagtgggttcagtgcttttataactgatcatcttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37922265 |
gttcttacctctcttttcaatttttcataggcttgtttattatgattgttttggttatggacatagtgggttcagtgcttttataactgatcatcttttt |
37922166 |
T |
|
| Q |
118 |
tgtcaaaaagttatcataatctatagaacaaagacaactagac |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37922165 |
tgtcaaaaagttatcataatctatagaacaaagacaactagac |
37922123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 196 - 304
Target Start/End: Complemental strand, 37922087 - 37921979
Alignment:
| Q |
196 |
cataatgaaaaattgattcttaaaacttcacttttttattctagtacttttctacaactgttttgatagtgaaaattcattgtcacttaacaactcatat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37922087 |
cataatgaaaaattgattcttaaaacttcacttttttattctagtacttttctacaactgttttgatagtgaaaattcattgtcacttaacaactcatat |
37921988 |
T |
|
| Q |
296 |
ttatattcc |
304 |
Q |
| |
|
||||||||| |
|
|
| T |
37921987 |
ttatattcc |
37921979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University