View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918_low_15 (Length: 249)
Name: NF2918_low_15
Description: NF2918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 39 - 232
Target Start/End: Original strand, 11040018 - 11040223
Alignment:
| Q |
39 |
ttgctggggaatggacaacatatcagtttttggtttgataactggtgtggtgattcattgattaaatccctaaatgtcacaactgatatgattgaggact |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11040018 |
ttgctggggaatggacaacatatcagtttttggtttgataactggtgtggtgattcattgattaaatccctaaatgtcacaactgatatgattgaggact |
11040117 |
T |
 |
| Q |
139 |
acacaatttctgag------------tttaactggaagcttgaatctctggagcaaagattttctgatatcagaagacttgtgtcacaagttactatctc |
226 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11040118 |
acacagtttctgagtatattgaaaattttaactggaagcttgaatctctggagcaaagatttcctgatatcagaagacttgtgtcacaagttactatccc |
11040217 |
T |
 |
| Q |
227 |
attgct |
232 |
Q |
| |
|
|||||| |
|
|
| T |
11040218 |
attgct |
11040223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University