View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918_low_18 (Length: 243)
Name: NF2918_low_18
Description: NF2918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918_low_18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 28053141 - 28053365
Alignment:
| Q |
19 |
gcgctaatggaatttactgaaatttggcaaaacctacaatcaataaggtgattctaacaaatccaatgtgataccactaaacaaaacacgatgagtttga |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053141 |
gcgctaatggaatttactgaaatttagcaaaacctacaatcaataaggtaattctaacaaatccaatgtgataccactaaacaaaacacgatgagtttga |
28053240 |
T |
|
| Q |
119 |
tcgaatcatatctagatcataattttattaaagagttagaaaatgcacgtgattcgatcaaaaattcacattcgatctaagtgcatgtttggtaacacgg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053241 |
tcgaatcatatctagatcataattttattaaagagttagaaaatgcatgtgattcgatcaaaaattcacattcgatctaagtgcatgtttggtaacacgg |
28053340 |
T |
|
| Q |
219 |
tgggattgacaaaatcacatgattt |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28053341 |
tgggattgacaaaatcacatgattt |
28053365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University