View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2918_low_22 (Length: 223)
Name: NF2918_low_22
Description: NF2918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2918_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 9 - 204
Target Start/End: Original strand, 32460797 - 32460992
Alignment:
| Q |
9 |
agtgagatgaatataactaacttttatatctctaatatcaggaaccacagggaaatcgaaaggagtgatgcttactcatcgcaacttgacggcgacggtg |
108 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32460797 |
agtgaaatgaatataactagcttttatatctctaatatcaggaaccacagggaaatcgaaaggagtgatgcttactcatcgcaacttgacggcgacggtg |
32460896 |
T |
 |
| Q |
109 |
gcggcatacaatgccgttaggattccgacggcgagtcctgcggtgtgtttgttaacagtgccgtgttttcacgtgtacggttttacgtaccttttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32460897 |
gcggcatacaatgccgttaggattccgacggcgaatcctgcggtgtgtttgttaacagtgccgtgttttcacgtgtacggttttacgtaccttttg |
32460992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University