View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2919_high_7 (Length: 240)
Name: NF2919_high_7
Description: NF2919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2919_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3146088 - 3145850
Alignment:
| Q |
1 |
tgcttgttacaaaaccaagtcatttaatgttggagtattacacttgattgttgattgatactgttaagtgcagagaagta----------------ttga |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3146088 |
tgcttgttacaaaaccaagtcatttaatgttggagtattacacttgattgttgattgatactgttaagtgcagagaagtagaaattgtagtaagtattga |
3145989 |
T |
 |
| Q |
85 |
tgcttggatgtgagcatttgatttcagtttttcttcaacgatctcaaagaatgaaaacaaaactgtcttgttttctagtttttgcaacatccttgaaacc |
184 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3145988 |
tgcttggatatgagcatttgatttcagtttttcttcaacgatctcaaagaatgaaaacaaaactgtcttgttttctagttattgcaacatccttgaaacc |
3145889 |
T |
 |
| Q |
185 |
ttgtttccagatcactctaaggctcttgttctctagtta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3145888 |
ttgtttccagatcactctaaggctcttgttctctagtta |
3145850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 28910368 - 28910312
Alignment:
| Q |
76 |
aagtattgatgcttggatgtgagcatttgatttcagtttttcttcaacgatctcaaa |
132 |
Q |
| |
|
|||||||| |||||| || | || |||||||||||||||| ||||||| |||||||| |
|
|
| T |
28910368 |
aagtattgttgcttgcatatcagtatttgatttcagttttccttcaacaatctcaaa |
28910312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University