View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2919_low_11 (Length: 224)
Name: NF2919_low_11
Description: NF2919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2919_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 88 - 208
Target Start/End: Original strand, 38304093 - 38304210
Alignment:
| Q |
88 |
ggaggaagagagtatttaacaaaacttgcatgagaagttaggggaatgggggtaatgccattgtcattgccaatgccgatgatatccttctccaatttgg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38304093 |
ggaggaagagagtatttaacaaaacttg-atgagaagttaggggaatggg--taataccattgtcattgccaatgccgatgatatccttctccaatttgg |
38304189 |
T |
 |
| Q |
188 |
tgtttcgcaatcccaatctca |
208 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38304190 |
tgtttcgcaatcccaatctca |
38304210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 38303804 - 38303870
Alignment:
| Q |
17 |
agattttacttaacaaccaacttaacttcgaattaaagactcatgattactcacaaaaactttataa |
83 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38303804 |
agattttacttaacaaccaacctaacttcgaattaaagactcatgattactcacaaaaactttataa |
38303870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University