View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2920_high_7 (Length: 289)
Name: NF2920_high_7
Description: NF2920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2920_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 76 - 289
Target Start/End: Original strand, 45683707 - 45683917
Alignment:
| Q |
76 |
gcatatcttccttagttgattaattacgaaattcgtaagaataggagaaataatacaactatgatgcaatagaatttgtgaccagccaattcccacctta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683707 |
gcatatcttccttagttgattaattacgaaattcgtaagaataggagaaataatacaactatgatgcaatagaatttgtgaccagccaattcccacctta |
45683806 |
T |
 |
| Q |
176 |
acttgttggatagattgattttgtaaaaatcaggggtggccttaagcatggagtagatggacggctgtccaagacaacannnnnnnnnagggatagcaaa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45683807 |
acttgttggatagattgattttgtaaaaatcaggggtggccttaagcatggagtagatggacggctgtccaagacaaca---ttttttagggatagcaaa |
45683903 |
T |
 |
| Q |
276 |
attattatttttac |
289 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45683904 |
attattatttttac |
45683917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University