View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2920_low_14 (Length: 250)
Name: NF2920_low_14
Description: NF2920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2920_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 28849669 - 28849425
Alignment:
| Q |
1 |
ccaacatcgagtcgctcgttctcaaaatcgctcactctattctctccggtaatggtttcgccttcgatgttccttctcgttccgctgcgaatcagcttta |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28849669 |
ccaacatcgagtctctcgttctcaaaatcgctcactctattctctccggtaatggtttcgccttcgatgttccttctcgttccgctgcgaatcagctata |
28849570 |
T |
|
| Q |
101 |
tgttcctgaacttgaccggattgttctcaaggataaatcgtcaattcgtcctttcgcgaatattgggactgtgaggaaaactgctattactgctaggatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28849569 |
tgttcctgaacttgaccggattgttctcaaggataaatcttcaattcgtcctttcgcgaatattgggactgtgaggaaaactgctattactgctaggatt |
28849470 |
T |
|
| Q |
201 |
attcagcttattcatcagctttgtcttaaagggattcatctcact |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28849469 |
attcagcttattcatcagctttgtcttaaagggattcatgtcact |
28849425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University