View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2920_low_16 (Length: 233)
Name: NF2920_low_16
Description: NF2920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2920_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 14794968 - 14794767
Alignment:
| Q |
14 |
agcagagattactattatgatggctaagacaacaaatactgacccaaatgatccattggatgaatggtggtcaggttcaggtggtgcatattggtatgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14794968 |
agcagagattactattatgatggctaagacaacaaatactgacccaaatgatccattggatgaatggtggtcaggttcaggtggtgcatattggtatgtg |
14794869 |
T |
 |
| Q |
114 |
acagtggttggatagacttgaactggttgctgttgttgttgctgctgcattggttgttcttgtaaagacatcttaggtaataggaaaattttgtttgtga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14794868 |
acagtggttggatagacttgaactggttgctgctgttgttgttgctgcattggttgttcttgtaaagacatcttaggtaatagg-aaattttgtttgtga |
14794770 |
T |
 |
| Q |
214 |
ggg |
216 |
Q |
| |
|
||| |
|
|
| T |
14794769 |
ggg |
14794767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University