View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2920_low_7 (Length: 337)
Name: NF2920_low_7
Description: NF2920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2920_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 329
Target Start/End: Original strand, 28858600 - 28858911
Alignment:
| Q |
18 |
tatgcaaaatattcataaactataccaaatacttttgttttgaatgcaaactgcaccaaatacttacttcctagcaagttgcaataatttagtagcttcc |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28858600 |
tatgcaaaatattcataaactatatcaaatacttttgttttgaatgcaaactgcaccaaatacttacttcctagcaagttgcaataatttagtagcttcc |
28858699 |
T |
|
| Q |
118 |
attgcatgggcaaaggaaaaagtaggttccattccacatgagcagacggaatagatgaggtgggactatcagctaattaagtccttcaattttaaggctg |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28858700 |
attgcatgggcaaaagaaaaagtaggttccattccacatgagcagacggaatagatgaggttggaccatcagctaattaagtccttcaattttaaggctg |
28858799 |
T |
|
| Q |
218 |
ctttcaagaagttcaataattttagctcacctaaaacgcgcttattttaataatttattccgtcaccactaagcaaatacctatttatacatatattcta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28858800 |
ctttcaagaagttcaataattttagctcacctaaaacgcgcttattttaataatttattccgtcaccactaagcaaatacctatttatacatatattcta |
28858899 |
T |
|
| Q |
318 |
tccattcttctc |
329 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28858900 |
tccattcttctc |
28858911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University