View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2921_high_8 (Length: 241)
Name: NF2921_high_8
Description: NF2921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2921_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 225
Target Start/End: Original strand, 18187767 - 18187977
Alignment:
| Q |
15 |
gcttgaaaactatacaaagtttttggatttcatgatgactaatgcttgatgaaattgtgcttttaaagttttcaagttttttcaattcatattttgaagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18187767 |
gcttgaaaactatacaaagtttttggatttcatgatgactgatgcttgatgaaattgtgcttttaaagttttcaagttttttcaattcatattttgaagt |
18187866 |
T |
|
| Q |
115 |
ctataatcctaaactggtttgatttgcaacttcaacttaactttgtggttcatattttggtcttacctaaatctaattattgtttatcaatttcaggaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18187867 |
ctataatcctaaactggtttgatttgcaacttcaacttaactttgtggttcatattttggtcttacctaaatctaattattgtttatcaatttcaggaac |
18187966 |
T |
|
| Q |
215 |
aatcaaggaaa |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
18187967 |
aatcaaggaaa |
18187977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 151 - 225
Target Start/End: Original strand, 18193145 - 18193218
Alignment:
| Q |
151 |
ttaactttgtggttcatattttggtcttacctaaatctaattattgtttatcaatttcaggaacaatcaaggaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18193145 |
ttaactttgtggttcatattttggtcttacct-aatctaattattgtttatcaatttcaggaatcatcaaggaaa |
18193218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 18192960 - 18193047
Alignment:
| Q |
72 |
tgcttttaaagttttcaagttttttcaattcatattttgaagtctataatcctaaactggtttgatttgcaacttcaacttaactttg |
159 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| |||||||||||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
18192960 |
tgcttttggagttttcaagtttttccaattcatatgttgaagtctatagtcctaaaatggtttgatttgcaacttcaacacaactttg |
18193047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 72
Target Start/End: Original strand, 18192759 - 18192799
Alignment:
| Q |
32 |
agtttttggatttcatgatgactaatgcttgatgaaattgt |
72 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
18192759 |
agtttttggatttcatgatggcagatgcttgatgaaattgt |
18192799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University