View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2921_low_17 (Length: 206)

Name: NF2921_low_17
Description: NF2921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2921_low_17
NF2921_low_17
[»] chr5 (1 HSPs)
chr5 (14-187)||(42362876-42363049)
[»] chr4 (1 HSPs)
chr4 (80-144)||(34787365-34787429)
[»] chr3 (1 HSPs)
chr3 (120-187)||(24380224-24380291)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 42362876 - 42363049
Alignment:
14 aagaaaatatcccaacagtggttttgtgaataatttctaccaattgaaactgcctcttttgccggcttttcagctgaacatgttgaggatatgttttaga 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42362876 aagaaaatatcccaacagtggttttgtgaataatttctaccaattgaaactgcctcttttgccggcttttcagctgaacatgttgaggatatgttttaga 42362975  T
114 acagcttatgtgatttccacaactggacttgcaatcatgtttccttacttcaatgaagttttaggagtcctagg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42362976 acagcttatgtgatttccacaactggacttgcaatcatgtttccttacttcaatgaagttttaggagtcctagg 42363049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 144
Target Start/End: Original strand, 34787365 - 34787429
Alignment:
80 ttttcagctgaacatgttgaggatatgttttagaacagcttatgtgatttccacaactggacttg 144  Q
    |||||| |||||||||||||||| |||||||  |||| |||||||||||||||||| ||| ||||    
34787365 ttttcatctgaacatgttgaggaaatgttttcaaacatcttatgtgatttccacaagtggccttg 34787429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 120 - 187
Target Start/End: Original strand, 24380224 - 24380291
Alignment:
120 tatgtgatttccacaactggacttgcaatcatgtttccttacttcaatgaagttttaggagtcctagg 187  Q
    ||||||||||| || ||||||||||||||  | ||||||||||||||| || || ||||||| |||||    
24380224 tatgtgatttcaaccactggacttgcaattttctttccttacttcaatcaaattctaggagtactagg 24380291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University