View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2921_low_17 (Length: 206)
Name: NF2921_low_17
Description: NF2921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2921_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 42362876 - 42363049
Alignment:
| Q |
14 |
aagaaaatatcccaacagtggttttgtgaataatttctaccaattgaaactgcctcttttgccggcttttcagctgaacatgttgaggatatgttttaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42362876 |
aagaaaatatcccaacagtggttttgtgaataatttctaccaattgaaactgcctcttttgccggcttttcagctgaacatgttgaggatatgttttaga |
42362975 |
T |
|
| Q |
114 |
acagcttatgtgatttccacaactggacttgcaatcatgtttccttacttcaatgaagttttaggagtcctagg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42362976 |
acagcttatgtgatttccacaactggacttgcaatcatgtttccttacttcaatgaagttttaggagtcctagg |
42363049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 144
Target Start/End: Original strand, 34787365 - 34787429
Alignment:
| Q |
80 |
ttttcagctgaacatgttgaggatatgttttagaacagcttatgtgatttccacaactggacttg |
144 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| |||| |||||||||||||||||| ||| |||| |
|
|
| T |
34787365 |
ttttcatctgaacatgttgaggaaatgttttcaaacatcttatgtgatttccacaagtggccttg |
34787429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 120 - 187
Target Start/End: Original strand, 24380224 - 24380291
Alignment:
| Q |
120 |
tatgtgatttccacaactggacttgcaatcatgtttccttacttcaatgaagttttaggagtcctagg |
187 |
Q |
| |
|
||||||||||| || |||||||||||||| | ||||||||||||||| || || ||||||| ||||| |
|
|
| T |
24380224 |
tatgtgatttcaaccactggacttgcaattttctttccttacttcaatcaaattctaggagtactagg |
24380291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University