View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_high_14 (Length: 280)
Name: NF2922_high_14
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 12606462 - 12606677
Alignment:
| Q |
18 |
attactagtcacactgtttgtgtcatggatgcttcaggtcaattaggctttagccttgttcaaagacttcttcaaagaggctataccgttcatgcatcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12606462 |
attactagtcacactgtttgtgtcatggatgcttcaggtcaattaggctttagccttgttcaaagacttcttcaaagaggctataccgttcatgcatcca |
12606561 |
T |
 |
| Q |
118 |
ttcaacaatatggtacatattatgtcattaattgcttttttattttgtcaaattcatcttaagaaaataagtggagaattcgaactctcatcactgcata |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| | || | | | ||||||||||| ||||||||||| |
|
|
| T |
12606562 |
ttcaacaatatggtacatattatgttattaattgcttttttattttgtcaaattca--ataagtggagaattcgtg-attcgaactctgatcactgcata |
12606658 |
T |
 |
| Q |
218 |
tctcaatattcttatcaat |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12606659 |
tctcaatattcttatcaat |
12606677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University