View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_high_28 (Length: 238)
Name: NF2922_high_28
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 132 - 226
Target Start/End: Complemental strand, 10165836 - 10165742
Alignment:
| Q |
132 |
gaagtaaaataatttaataagtttgaaaaaatagctttgatagaatgcaaatccgatcaatgattttagtgtcgtaaatattacagattctgatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10165836 |
gaagtaaaataatttaataagtttgaaaaagtagctttgatagagtgcaaatccgatcaatgattttagtgtcgtaaatattacagattcggatg |
10165742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University