View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_high_30 (Length: 219)
Name: NF2922_high_30
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_high_30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 82 - 219
Target Start/End: Complemental strand, 46140449 - 46140312
Alignment:
| Q |
82 |
atgtttttccaaatatgcttacaaactgttcgtctattgttttcagacaagacaacccaggtaaaactaaaacctattacgattcaaatatgttatacca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46140449 |
atgtttttccaaatatgcttacaaactgttcttctattgttttcagacaagacaacccaggtaaaactaaaacctattacgattcaaatatgttatacca |
46140350 |
T |
 |
| Q |
182 |
tttcatgtgtttgtttttgtataaaatgaatgaaatta |
219 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46140349 |
tttcatgtgtttgtttttatataaaatgaatgaaatta |
46140312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University