View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_low_19 (Length: 282)
Name: NF2922_low_19
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 264
Target Start/End: Complemental strand, 14254253 - 14254007
Alignment:
| Q |
14 |
atgaaccaacgagtgttaaaagactaatatgccctttttctagtttcgcccgtgaatcaaacaaacaaacgccaccgcaactcggtactctaccaaattc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14254253 |
atgaaccaacgagtgttaaaagactaatatgccctttttctagtttcgcccgtgaat----taaacaaacgccaccgcaactcggtactctaccaaattc |
14254158 |
T |
|
| Q |
114 |
ttcaccggtataaataactgctttttaagcgatctaaaaagtaggtatccaaagtaaattctcatttaaacaatagtttagtgtaagtttggttccacct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14254157 |
ttcaccggtataaataactgctttttaagcgatctaaaaagtaggtatccaaagtaaattctcatttaaacaatagtttagtgtaagtttggttccacct |
14254058 |
T |
|
| Q |
214 |
taccaaaagtgattatgagtgtattaattatgtaaaattgattaccgttat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14254057 |
taccaaaagtgattatgagtgtattaattatgtaagattgattaccgttat |
14254007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University