View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_low_22 (Length: 262)
Name: NF2922_low_22
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_low_22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 262
Target Start/End: Complemental strand, 35632812 - 35632567
Alignment:
| Q |
12 |
acagaacagaagcaatggagccaagtccaatagattagattagattagggaccacatgagaaaagggagtggaagttcaacccataacataactagttag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35632812 |
acagaacagaagcaatggagccaagtccaatagattagattag-----ggaccacatgagaaaagggagtggaagttcaacccataacataactagttag |
35632718 |
T |
|
| Q |
112 |
aacgcgttttttgtgctgtgtttggcttttgctacatttctatttctataatgtttttgattgataaatgcttaactatgagtgggtcgtagttgggtga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35632717 |
aacgcgttttttgtgctgtgtttggcttttgctacatttctatttctataatgtttttgattgataaatgcttaactatgagtgggtcgtagttgggtga |
35632618 |
T |
|
| Q |
212 |
cagacagcaagatatgttatgnnnnnnnnctgagtcagccttcaattattt |
262 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35632617 |
cagacagcaagatatgttatgttttttttctgagtcagccttccattattt |
35632567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University