View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_low_24 (Length: 253)
Name: NF2922_low_24
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 31105905 - 31106150
Alignment:
| Q |
7 |
gtgagatgaaaaaatagctagaaagttgttataaatatagagttatattgagttttcttcgccccgaacatccctagtctattgattgtacttggggctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
31105905 |
gtgagatgaaaaaatagctagaaagttgttataaatatagagttatattgagttttcttcaccccgaacatccctagtctactggttgtacttggggctt |
31106004 |
T |
|
| Q |
107 |
gggtagttgtgtgtcttgagagagtttacaacttttccgtgcaaaatcaaattcattttatctaactaacatttgtgaaatagaaaatgtcatttgcacc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31106005 |
gggtagttgtgtgtcttgagagagtttacaacttttccgtgcaaaatcaaactcattttatctaactaacatttgtgaaatagaaaatgtcatttgcatc |
31106104 |
T |
|
| Q |
207 |
taactaggctgtgttaaaggatataataatgtgatctaaaaaatgt |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31106105 |
taactaggctgtgttaaaggatataatgatgtgatctaaaaaatgt |
31106150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 31107828 - 31107895
Alignment:
| Q |
163 |
tttatctaactaacatttgtgaaatagaaaatgtcatttgcacctaactaggctgtgttaaaggatataata |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
31107828 |
tttatctaactaacatttgtgcaatagaaaatgtcatctgcac----agaggctgtgttaaaggatataata |
31107895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 45 - 133
Target Start/End: Complemental strand, 3511763 - 3511677
Alignment:
| Q |
45 |
agagttatattgagttttcttcgccccgaacatccctagtctattgattgtacttggggcttgggtagttgtgtgtcttgagagagttt |
133 |
Q |
| |
|
||||||||||||||||||| || || | |||| | ||||||| ||| |||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3511763 |
agagttatattgagttttcatcaccac-aacaactctagtcttttgggtgta-ttggggattgggtagttgtgtgtcttgagagagttt |
3511677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University