View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_low_27 (Length: 249)
Name: NF2922_low_27
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 38196779 - 38196618
Alignment:
| Q |
1 |
agcttgtgatatcaatagaaagagaaatatatataccttaaaagcagcatgattcccatcagaagtcaaagtagactttctcttatgcaagttagaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196779 |
agcttgtgatatcaatagaaagagaaatatatataccttaaaagcagcatgattcccatcagcagtcaaagtagactttctcttatgcaagttagaatga |
38196680 |
T |
 |
| Q |
101 |
gcctgatcaagacacaacaaaatcacatgtgaaatgtgaaatactgaaaatgtgaagactaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196679 |
gcctgatcaagacacaacaaaatcacatgtgaaatgtgaaatactgaaaatgtgaagactaa |
38196618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 38196617 - 38196563
Alignment:
| Q |
186 |
cttttttcggatttatccatgagcgtatttgatcaaattattatcaatgtctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38196617 |
cttttttcggatttatccatgagcgtatttgatcaaattattttcaatgtctgtg |
38196563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University