View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_low_31 (Length: 242)
Name: NF2922_low_31
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 35632260 - 35632471
Alignment:
| Q |
17 |
aatgatatcaacacgatctttataacattttttattaggtaaaacatatctggatttcgtcattttacgtaagtttcaataacattcatttaaactataa |
116 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
35632260 |
aatgatatcaacacgttcattacaacattttttattaggtaaaacatacgtggatctcgtcattttatgtaagtttcaatagcattcatttaaactataa |
35632359 |
T |
 |
| Q |
117 |
agctatttttattaaagagagtactctaagttaagagattaattttgcttagatttatgaaaccaaaatagtgtatgtatgactacgtcaaaagtgtggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35632360 |
agctatttttattaaagagagtactctaagttaagagattaattttgcttagatttatgaaaccaaaatagtgtatgtatgactacgtcaaaagtgtggt |
35632459 |
T |
 |
| Q |
217 |
gattcatcatca |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35632460 |
gattcatcatca |
35632471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University