View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2922_low_34 (Length: 238)

Name: NF2922_low_34
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2922_low_34
NF2922_low_34
[»] chr2 (1 HSPs)
chr2 (132-226)||(10165742-10165836)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 132 - 226
Target Start/End: Complemental strand, 10165836 - 10165742
Alignment:
132 gaagtaaaataatttaataagtttgaaaaaatagctttgatagaatgcaaatccgatcaatgattttagtgtcgtaaatattacagattctgatg 226  Q
    |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||    
10165836 gaagtaaaataatttaataagtttgaaaaagtagctttgatagagtgcaaatccgatcaatgattttagtgtcgtaaatattacagattcggatg 10165742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University