View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2922_low_35 (Length: 229)
Name: NF2922_low_35
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2922_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 15758159 - 15758273
Alignment:
| Q |
97 |
caacaaattcatgtttccttccatctgttctcgtttctcgccatttcttgctgatacgttctgtttcagtatttacatactacgtacgtactgtaatcat |
196 |
Q |
| |
|
||||||||||||||||||| | || |||| ||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15758159 |
caacaaattcatgtttcctccgatatgttttcgtttctcgccatttcctgttgatacgttctgtttcagtatttacatac----tacgtactgtaatcat |
15758254 |
T |
 |
| Q |
197 |
atattattcctagcctatg |
215 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
15758255 |
atattattcctagcctatg |
15758273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University