View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2922_low_35 (Length: 229)

Name: NF2922_low_35
Description: NF2922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2922_low_35
NF2922_low_35
[»] chr1 (1 HSPs)
chr1 (97-215)||(15758159-15758273)


Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 15758159 - 15758273
Alignment:
97 caacaaattcatgtttccttccatctgttctcgtttctcgccatttcttgctgatacgttctgtttcagtatttacatactacgtacgtactgtaatcat 196  Q
    ||||||||||||||||||| | || |||| ||||||||||||||||| || |||||||||||||||||||||||||||||    ||||||||||||||||    
15758159 caacaaattcatgtttcctccgatatgttttcgtttctcgccatttcctgttgatacgttctgtttcagtatttacatac----tacgtactgtaatcat 15758254  T
197 atattattcctagcctatg 215  Q
    |||||||||||||||||||    
15758255 atattattcctagcctatg 15758273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University