View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2923_high_17 (Length: 342)
Name: NF2923_high_17
Description: NF2923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2923_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 5 - 321
Target Start/End: Complemental strand, 43129476 - 43129160
Alignment:
| Q |
5 |
gagtgagatgaacaatccttcaatgaaaactgctgcgagtgcgctttggtaggagatagtgccggaaccgtgaaagcccacgacggtgtaagcgaagtaa |
104 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129476 |
gagtaagaagaacattccttcaatgaaaactgctgcgagtgcgctttggtaggagatagtgccggaaccgtgaaagcccacgacggtgtaagcgaagtaa |
43129377 |
T |
|
| Q |
105 |
gcgtttgagcccatacctggagcaaggcctaatgggagattagcaaaagcacccatgatgaagcaaccaatgagggaagaagccacggttgcgacgatca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129376 |
gcgtttgagcccatacctggagcaaggcctaatgggagattagcaaaagcacccatgatgaagcaaccaatgagggaagaagccacggttgcgacgatca |
43129277 |
T |
|
| Q |
205 |
agtcttttcgggttttatcaagacaagcggcgtagcccgggttaacaggggcaaatttgcatgagatatcaggctgaatgagatgaaatgatgggccggt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129276 |
agtcttttcgggttttatcaagacaagcggcgtagcccgggttaacaggggcaaatttgcatgagatatcaggctgaatgagatgaaatgatgggccggt |
43129177 |
T |
|
| Q |
305 |
acagtttgaggtagaga |
321 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43129176 |
acagtttgaggtagaga |
43129160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University