View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2923_high_22 (Length: 277)
Name: NF2923_high_22
Description: NF2923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2923_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 260
Target Start/End: Complemental strand, 10126784 - 10126740
Alignment:
| Q |
216 |
ttttgagcagtattactcatacccgggttgtcagtcaccctcact |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10126784 |
ttttgagcagtattactcatacccgggttgtcagtcaccctcact |
10126740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 227 - 260
Target Start/End: Complemental strand, 10126724 - 10126691
Alignment:
| Q |
227 |
attactcatacccgggttgtcagtcaccctcact |
260 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
10126724 |
attacacatacccgggttgtcagtcaccctcact |
10126691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University