View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2923_high_22 (Length: 277)

Name: NF2923_high_22
Description: NF2923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2923_high_22
NF2923_high_22
[»] chr4 (2 HSPs)
chr4 (216-260)||(10126740-10126784)
chr4 (227-260)||(10126691-10126724)


Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 260
Target Start/End: Complemental strand, 10126784 - 10126740
Alignment:
216 ttttgagcagtattactcatacccgggttgtcagtcaccctcact 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
10126784 ttttgagcagtattactcatacccgggttgtcagtcaccctcact 10126740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 227 - 260
Target Start/End: Complemental strand, 10126724 - 10126691
Alignment:
227 attactcatacccgggttgtcagtcaccctcact 260  Q
    ||||| ||||||||||||||||||||||||||||    
10126724 attacacatacccgggttgtcagtcaccctcact 10126691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University