View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2923_high_35 (Length: 202)

Name: NF2923_high_35
Description: NF2923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2923_high_35
NF2923_high_35
[»] chr8 (2 HSPs)
chr8 (19-116)||(2337004-2337101)
chr8 (132-188)||(2336953-2337008)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 2337101 - 2337004
Alignment:
19 attgttttcattctgtcttacatgtattgattttggatataagaaacagtttgattgaattaaacacgctcaagtttatttatagtgaatatgattaa 116  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
2337101 attgtttttattctgtcttacatgtattgattttggatataagaaacagtttgattgaattaaacacgctcaagtatatttatagtgaatatgattaa 2337004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 132 - 188
Target Start/End: Complemental strand, 2337008 - 2336953
Alignment:
132 attaaacatctaagaccacgtgatctagtgtagagtgatagctgcggggtgtctgtg 188  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||    
2337008 attaaacatctaagaccacgtgatctagtgt-gagtaatagctgcggggtgtctgtg 2336953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University