View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2923_low_27 (Length: 267)
Name: NF2923_low_27
Description: NF2923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2923_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 26540502 - 26540234
Alignment:
| Q |
1 |
tttaatatgtttgcctatgatacatcgacctatcaagccatgatcaagtatttgaacaacatgattttttgaatccagggttaaagg---acatttcatc |
97 |
Q |
| |
|
||||||||||||| ||||| | |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26540502 |
tttaatatgtttgtatatgagaaatcgacctattaagccatgatcaagtatttcaacaacatgattttttgaatccagggttaaaggttaacatttcatc |
26540403 |
T |
 |
| Q |
98 |
aacgatagtgagaccttcaagggtttagggtaaaggcattcatgagatgggttttgataattggaatgctaaggaaaaggatgatttaaatagtgaaaag |
197 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26540402 |
aacgatagtgagaccttcaagggtttaaggcaaaggcatccatgagatgggttttgataattggaacgctaaggaaaaggatgatttaaatagtgaaaag |
26540303 |
T |
 |
| Q |
198 |
gtttggaagcatgtacaagagattgtagaggttagagttttcaatgtggagaataatctacccacgaga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
26540302 |
gtttggaagcatgtacaagagattgtagaggttagagttttcaatgtggagaagaatcgacccatgaga |
26540234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University