View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2923_low_28 (Length: 262)
Name: NF2923_low_28
Description: NF2923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2923_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 26540797 - 26540594
Alignment:
| Q |
19 |
aggaagagatctaagccatgtgcaacttgtggttgaatgagaccaaaaggaaggttgtgaacctgaatccatatatcaagatggtccaggcttacctgtt |
118 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26540797 |
aggaagagacctaacccatgtgcaacttgtggttgaatgagaccaaaaggaaggttgtgaacctgaatccatatatcaagatggtccaggctcacctgtt |
26540698 |
T |
 |
| Q |
119 |
gggaacaaccccaagggctactctatcgac--ctagatagtaggtgtcataaagtcattgtccttcatcaagcaccttagtcacgccgagatgatgatga |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26540697 |
gggaacaaccccaggggctactctatcgaccactagatggtaggtgtcataaagtcatggtccttcatcaagcaccttagtcacgtcgagatgatgatga |
26540598 |
T |
 |
| Q |
217 |
tact |
220 |
Q |
| |
|
|||| |
|
|
| T |
26540597 |
tact |
26540594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University