View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2923_low_41 (Length: 202)
Name: NF2923_low_41
Description: NF2923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2923_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 2337101 - 2337004
Alignment:
| Q |
19 |
attgttttcattctgtcttacatgtattgattttggatataagaaacagtttgattgaattaaacacgctcaagtttatttatagtgaatatgattaa |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2337101 |
attgtttttattctgtcttacatgtattgattttggatataagaaacagtttgattgaattaaacacgctcaagtatatttatagtgaatatgattaa |
2337004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 132 - 188
Target Start/End: Complemental strand, 2337008 - 2336953
Alignment:
| Q |
132 |
attaaacatctaagaccacgtgatctagtgtagagtgatagctgcggggtgtctgtg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
2337008 |
attaaacatctaagaccacgtgatctagtgt-gagtaatagctgcggggtgtctgtg |
2336953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University