View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2924_low_3 (Length: 329)
Name: NF2924_low_3
Description: NF2924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2924_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 9 - 312
Target Start/End: Original strand, 35119602 - 35119905
Alignment:
| Q |
9 |
agcacagacacttcaaatcaaaggtggtgaagacgtgtcagatgaccgagtctggaatagacacgacactgacatatgtgattacaaattacttgtgcta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35119602 |
agcacagacacttcaaatcaaaggtggtgaagaggtgtcagatgaccgagtctggcatagacacgacactgacatatgtgattacaaattacttgtgcta |
35119701 |
T |
 |
| Q |
109 |
ttttctcaaattttcacaaattattattagtgtcaacgtgccggtgtcgatgtttcataggtccccttcatatggggaaacaatagtgaatgttcgcaca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35119702 |
ttttctcaaattttcacaaattattattagtgtcaatgtgccggtgtcgatgtttcataggtccccttcatatggggaaagaatagtgaatgttcgcaca |
35119801 |
T |
 |
| Q |
209 |
gttttcaaaaggtattattacctattagcagttggacacaagcgagtcccttccttgctgatcttcccaactcgaatcgaaacaagcggcaaacagaagc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35119802 |
gttttcaaaaggtattattacctattagcagttggacacaagcgagtcccttccttgctgatcttcccaactcgaatcgaaacaagcggcaaacagaagc |
35119901 |
T |
 |
| Q |
309 |
atct |
312 |
Q |
| |
|
|||| |
|
|
| T |
35119902 |
atct |
35119905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 168
Target Start/End: Original strand, 39120399 - 39120449
Alignment:
| Q |
118 |
attttcacaaattattattagtgtcaacgtgccggtgtcgatgtttcatag |
168 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
39120399 |
attttctcaatttattattagtgtcaacgtgtcagtgtccatgtttcatag |
39120449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University