View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_11 (Length: 490)
Name: NF2926_high_11
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 235 - 474
Target Start/End: Original strand, 36651634 - 36651873
Alignment:
| Q |
235 |
attcatatcaaaatccggaacaaccccaccggaactagacatcttgatctctcaagtgcataaacaattacactctccggtctcaaatataaactacaaa |
334 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651634 |
attcaaatcaaaatccggaacaaccccaccggaactagacatcttgatctctcaagtgcataaacaattacactctccggtctcaaatataaactacaaa |
36651733 |
T |
 |
| Q |
335 |
aattgcagatctaatagtgatctaagtataattcaagtaccattactctgtttaatagtactggtattccaaatttatgtagttgaaataaatttaaatt |
434 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651734 |
aattgcaggtctaatagtgatataagtataattcaagtaccattactctgtttaatagtactggtattccaaatttatgtagttgaaataaatttaaatt |
36651833 |
T |
 |
| Q |
435 |
caatttccaatattttttatattccgatgaaatggctttc |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651834 |
caatttccaatattttttatattccgatgaaatggctttc |
36651873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University