View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_20 (Length: 417)
Name: NF2926_high_20
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 9 - 403
Target Start/End: Complemental strand, 1848955 - 1848582
Alignment:
| Q |
9 |
agcagagaaaaaagtgcttggtaaccctgagtctgatgtcggggttccattagattgttcctggactagaatagattgagcaccaacaacgagatctttg |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1848955 |
agcagagaaaaaagtgcttggtatccctgagtctgatgtcggggttccattagattgttcctggactagaatagattgagtaccaacaacgagatctttg |
1848856 |
T |
|
| Q |
109 |
ccaatgataatatcattggtgtttttgggatacgaaagtaggtcaccccctccagatgccaatgcagatttaactctaaacgcagcactgtgagttgagg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1848855 |
ccaatgataatatcattggtgtttttgggatacgaaagtaggtcaccccctccagatgccaatgcagatttaactctaaacgcagcactgtgagttgagg |
1848756 |
T |
|
| Q |
209 |
aagatttataattcagtttgacaagagggaaatcattgaacaatttgaagtgattggatggcctacattgaagaaaagatcaaatcaaagattaacttga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1848755 |
aagatttataattcagtttgacaagagggaaatcattgaacaatttgaagtgattggatggcctacattgaagaaa------------agattaacttga |
1848668 |
T |
|
| Q |
309 |
attaatagcatctaaacataaaaccaaagagaaactaacaaagaaaatcatgaaaattaagacttcaatgagaagcttctcagctaagaaatcca |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1848667 |
attaatagcatctaaacataaaaccaaagagaaactaacaaa---------gaaaattaagacttcaatgagaagcttctcagctaagaaatcca |
1848582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University