View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_29 (Length: 348)
Name: NF2926_high_29
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 38982321 - 38982638
Alignment:
| Q |
18 |
aaagtcatg-tatgtacatgtgatatagagcatctttattacaaattataaaacaaatgattttgacattaaatagagataaattctaagacatcgatgc |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38982321 |
aaagtcatggtatgtacatgtgatatagagcatctttattacaaattataaaacaaatgattttgacattaaatagagataaattctaagacatcgatgc |
38982420 |
T |
|
| Q |
117 |
agacatactcgggagggagggtatggttctctctcctctccctaaccgtttttctccggtgaatttatctaccttcggtgcagctccggtggccgttttt |
216 |
Q |
| |
|
||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38982421 |
agagaaactcggga----gggtatggttctctctcctctccctaaccgtttttctccggtgaatttatctaccttcggtgcagctccggtggccgttttt |
38982516 |
T |
|
| Q |
217 |
tcaccgttttattcgattatcttcgtcgtttcacatgcgtttcttgcctccatcatctgcatcgcttctctccgcgggctttttgcgtctttgtgtttgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
38982517 |
tcaccgttttattcgattatcttcgtcgtttcacatgcgtttcttgcctccatcatctgcatcgcttctctccgcgggctttttgcctcttagtgtttgg |
38982616 |
T |
|
| Q |
317 |
cggtggtggttttagctctctg |
338 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38982617 |
cggtggtggttttagctctctg |
38982638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 91
Target Start/End: Complemental strand, 38985405 - 38985331
Alignment:
| Q |
18 |
aaagtcatgtatgtacatgtgatatagagcatctttattacaaatt-ataaaacaaatgattttgacattaaata |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
38985405 |
aaagtcatgtatgtacatgtgatatagagcatgtttactacaaattaataaaacaaatgattttcacattaaata |
38985331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University