View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_30 (Length: 343)
Name: NF2926_high_30
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 126 - 329
Target Start/End: Complemental strand, 6730788 - 6730583
Alignment:
| Q |
126 |
accaaaaatatccttcataagtttgtttatgacgttttgtnnnnnnntaataatt--ataaagttggccaagaggagtgctagttatggcatgttttcgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| | | || |||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
6730788 |
accaaaaatatccttcataagtttgtttatgaagttttgtaaaaaatttttttttttataaagttggccaagaggagtgctagttatagcatgtttccgt |
6730689 |
T |
 |
| Q |
224 |
tgagctttcttagttgaaagttgatgcttcaattttgaggttctcagatcaaatatgacgtcaatcgcttacaacatatttttgaaaattgatcatcata |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6730688 |
tgagctttcttagttgaaagttgatgcttcaattttgaggttctcagatcaaatatgacgtcaatcgcttacaacatatttttgaaaattgatcatcata |
6730589 |
T |
 |
| Q |
324 |
aataaa |
329 |
Q |
| |
|
||||| |
|
|
| T |
6730588 |
cataaa |
6730583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 43617945 - 43617887
Alignment:
| Q |
224 |
tgagctttcttagttgaaagttgatgcttcaattttgaggttctcagatcaaatatgac |
282 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||| | |||| |||||| |
|
|
| T |
43617945 |
tgagctttcttagtacaaagttgatgcttcaactatgaggttctcggttcaagtatgac |
43617887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University