View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2926_high_32 (Length: 335)

Name: NF2926_high_32
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2926_high_32
NF2926_high_32
[»] chr2 (1 HSPs)
chr2 (18-153)||(29161813-29161948)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 29161813 - 29161948
Alignment:
18 ttttaccgaagaaatgggcggttgttaggtcttttcatgttaagttgttggagtctcttgctttaccggtttaccaggctgttccggatgttaggttgaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29161813 ttttaccgaagaaatgggcggttgttaggtcttttcatgttaagttgttggagtctcttgctttaccggtttaccaggctgttccggatgttaggttgaa 29161912  T
118 gattgagggtgttaaggatttggaggataagttggt 153  Q
    ||||||||| ||||||||||||||||||||||||||    
29161913 gattgagggggttaaggatttggaggataagttggt 29161948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University