View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_54 (Length: 255)
Name: NF2926_high_54
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 5 - 236
Target Start/End: Original strand, 49065150 - 49065381
Alignment:
| Q |
5 |
caattcaaagtcaaatttagttacatgtttggacatagataattcttctaaaacatcctcagaaaatttcacttgtggctctgaatcaacttcagagcca |
104 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065150 |
caattcaatgtcaaatttagttacatgtttggacatagataattcttctaaaacatcctcagaaaatttcacttgtggctctgaatcaacttcagagcca |
49065249 |
T |
 |
| Q |
105 |
cgttttttcacttgcaactactgcaagagaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065250 |
cgttttttcacttgcaactactgcaagagaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaa |
49065349 |
T |
 |
| Q |
205 |
gaggacggaggacgatgttctcagcaacagga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49065350 |
gaggacggaggacgatgttctcagcaacagga |
49065381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 132 - 210
Target Start/End: Complemental strand, 2867194 - 2867116
Alignment:
| Q |
132 |
agaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaagaggac |
210 |
Q |
| |
|
|||||||||| || ||||||||| | || ||||| |||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
2867194 |
agaaaattctatagctcacaagcattaggtggacaccaaaatgctcacaaaagagagagatcaatagcaaaaagaggac |
2867116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University