View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_58 (Length: 250)
Name: NF2926_high_58
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_58 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 47 - 250
Target Start/End: Complemental strand, 51706793 - 51706590
Alignment:
| Q |
47 |
gtaccgaatcaagtagaaggagtagggggtggaggaacaacagtagccgttgaagatgcatcagcagaaatgacaattgtaaaatcaggaggcagtggtg |
146 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51706793 |
gtaccgaatcaagtagaaggagtaggaggcggaggaacaacagtagccgttgaagatgcatcagcaggaatgacaattgtaaaatcaggaggcagtggtg |
51706694 |
T |
|
| Q |
147 |
gcaacggagcatactctgttggtttccgattcctatctgacagtgatgattttctgggcctcgtcttcatgtgatgtgcagttgatttcttctgtggcct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51706693 |
gcaacggagcatactctgttggtttccgattcctatccgacagtgatgattttctgggtctcgtcttcatgtgatgtgcagttgatttcttctgtggcct |
51706594 |
T |
|
| Q |
247 |
cgat |
250 |
Q |
| |
|
|||| |
|
|
| T |
51706593 |
cgat |
51706590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University