View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_59 (Length: 249)
Name: NF2926_high_59
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_59 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 36651105 - 36651342
Alignment:
| Q |
12 |
aagaatcaacaacaatgctattcttcatcaagtagtccaccttatcaacaaagttcttgtatttaaccttcacacaagtgttatcattggatccacactc |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
36651105 |
aagaatcaacaacaatgttattcttcatcaagtagtccaccttatcaccaaagttcttgtatttaaccttcacacaagtgatatcattgcatccacactc |
36651204 |
T |
 |
| Q |
112 |
caccacattagacacaaccgccaagctataactcataaccattagatatcccttgaggaacacatgttacatgtcagttttaacgaggagacgctgatgt |
211 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
36651205 |
caccacattagacgcaactgccaagctataactcataaccattagatatcccttgaggaacacatgtttcatgtcggttttaacgaggagacgctgatgt |
36651304 |
T |
 |
| Q |
212 |
atgtaattcaattcagcctcatacaccccatttacact |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651305 |
atgtaattcaattcagcctcatacaccccatttacact |
36651342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 36642257 - 36642181
Alignment:
| Q |
138 |
tataactcataaccattagatatcccttgaggaacacatgttacatgtcagttttaacgaggagacgctgatgtatg |
214 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| || | || |||||||||||| ||||||| |
|
|
| T |
36642257 |
tataactcataaccatgagatatcctttgaggaacacatgcctcatgttaggtctagcgaggagacgctaatgtatg |
36642181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University