View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_68 (Length: 240)
Name: NF2926_high_68
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 38 - 225
Target Start/End: Complemental strand, 4776189 - 4775996
Alignment:
| Q |
38 |
atatataaaactaataatagccatttagaaaagttgcgccctacaacactttaagaggtagattcacttacaataattgattttaatgtaaatatttgaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4776189 |
atatataaaactaataatagccatttagaaaagttgcgccctacaacactttaagaggtagattcacttataataattgattttaatgtaaatatttgaa |
4776090 |
T |
|
| Q |
138 |
taatttgaaagaa---gctcgttatctattttgtttctaaatcttaacttgacgatttttat---tacaatcaaacatctctcttagttgatag |
225 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4776089 |
taatttgaaagaagctgctcgttatctattttgtttctaaatcttatcttgacgatttttattactacaatcaaacatctctcttagttgatag |
4775996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University