View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_74 (Length: 238)
Name: NF2926_high_74
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_74 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 42380129 - 42380350
Alignment:
| Q |
1 |
tcttgactttcacaattgtgcattatctgtctgtaacattttctatttcagtttatccggttggaacagagttatttgctcttatagacatgatatatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42380129 |
tcttgactttcacaattgtgcattatctgtctgtaacattttctatttcagtttatccggttggaacagagttatttgctcttatagacatgatatatga |
42380228 |
T |
|
| Q |
101 |
ttttgttcaccatggcctttcttgtaggtgtttgcttcctgattttttaaaggtgtttctctaattcatgtgtctaaaggttagactaatttctcttctg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
42380229 |
ttttgttcatcatggcctttcttgtaggtgtttgcttcctgattttttaaaggtgtttctctaattgatgtgtctaaaggttagactgatttctcttctg |
42380328 |
T |
|
| Q |
201 |
tttagcctcaaatactaaacct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42380329 |
tttagcctcaaatactaaacct |
42380350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University