View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_80 (Length: 230)
Name: NF2926_high_80
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 4546883 - 4546687
Alignment:
| Q |
10 |
ttaattgaaagtaatcacatcacacatgtcagacacgagacgaaactaaccggcgtgggttgagagagaagaagcacgttgtgtaagaataacacgcaaa |
109 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546883 |
ttaattgaaagtaa----atcacacatgtcagacacgaaactaaactaaccggcgtgggttgagagagaagaagcacgttgtgtaagaataacacgcaaa |
4546788 |
T |
 |
| Q |
110 |
ttcccatcttgaccttcgaataaacaaataagaaccgctgctctcttgttttgtttgtaaattgaagtttctttgagtggattggtgttggaaggtgatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4546787 |
ttcccatcttgaccttcgaataaacaaataagaaccgctgctctcttgttttgtttgtaaattgaagtttcttttagtggattggtgttggaaggtgatt |
4546688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University