View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2926_high_83 (Length: 228)

Name: NF2926_high_83
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2926_high_83
NF2926_high_83
[»] chr7 (1 HSPs)
chr7 (17-212)||(38013572-38013774)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 38013774 - 38013572
Alignment:
17 agatagagttgaaaattaaccagctaatggaaattattgaaaccccagttagcgtaattgtccatggctgacacctaaaacaaa----------tacatc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||    
38013774 agatagagttgaaaattaaccagctaatggaaattattgaaaccccagttagcgtaattgtccatggctgacacctaaaacaaaacatgacaaatacatc 38013675  T
107 aaatttagttctaaaaattgaagaaaatgattaaggaatgaagatgaaccataccaagatggtttggtgtcccaaacagattcgtattcgagggaaaggt 206  Q
    ||||||||||||||||||||||   |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38013674 aaatttagttctaaaaattgaa---aatgattaagtaatgaagatgaaccataccaagatggtttggtgtcccaaacagattcgtattcgagggaaaggt 38013578  T
207 tgttga 212  Q
    ||||||    
38013577 tgttga 38013572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University