View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_90 (Length: 211)
Name: NF2926_high_90
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_90 |
 |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0578 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 5 - 193
Target Start/End: Complemental strand, 776 - 586
Alignment:
| Q |
5 |
tgtcgaagaaaatagatcagaacctggtttggttatatagcaagttagttgcttatgtttgtggattgtt--gtttaattcttacgaagtaactattttt |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
776 |
tgtcgtagaaaatagatcagaacctggtttggttatataacaagttagttggttatgtttgtggattgtatagtttaattcttacgaagtaactattttt |
677 |
T |
 |
| Q |
103 |
tagaatcgagtcgagtttcaaggctgtgaaattgatggttatgcatctcaagttgtcaacactttcattgtgatttgaattttgctttggg |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
676 |
tagaatcgagtcgagtttcaaggctgtcaaattaatggttatgcatctcaagttgtcaacactttcattgtgatttgaattttgctttggg |
586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 5 - 193
Target Start/End: Complemental strand, 4954789 - 4954599
Alignment:
| Q |
5 |
tgtcgaagaaaatagatcagaacctggtttggttatatagcaagttagttgcttatgtttgtggattgtt--gtttaattcttacgaagtaactattttt |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4954789 |
tgtcgtagaaaatagatcagaacctggtttggttatataacaagttagttggttatgtttgtggattgtatagtttaattcttacgaagtaactattttt |
4954690 |
T |
 |
| Q |
103 |
tagaatcgagtcgagtttcaaggctgtgaaattgatggttatgcatctcaagttgtcaacactttcattgtgatttgaattttgctttggg |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4954689 |
tagaatcgagtcgagtttcaaggctgtcaaattaatggttatgcatctcaagttgtcaacactttcattgtgatttgaattttgctttggg |
4954599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University