View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_high_91 (Length: 208)
Name: NF2926_high_91
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_high_91 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 30505789 - 30505586
Alignment:
| Q |
1 |
acccctccgtatcttcattcctttactactccacaccttagtcacgaaaccgtttcatatatcccctctgtaataatagttcttatttcttttagggtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30505789 |
acccctccgtatcttcattcctttactactccacaccctagtcacgaaaccgtttcatatatcccctctataataatagttcttatttcttttagggtga |
30505690 |
T |
|
| Q |
101 |
tgaatttattaagttagtggttacaaaatcttagttgctcgaaaccaaagttaatgtgttgaagaggaatatgaaagtgacggagattcggttaaagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30505689 |
tgaatttattaagttagtggttacaaaatcttagttgctcgaaaccaaagttaatgtgttgaagaggaatatgaaagtgacggaaattcggttaaagagg |
30505590 |
T |
|
| Q |
201 |
gaat |
204 |
Q |
| |
|
|||| |
|
|
| T |
30505589 |
gaat |
30505586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University