View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_34 (Length: 350)
Name: NF2926_low_34
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 59 - 306
Target Start/End: Complemental strand, 2230947 - 2230709
Alignment:
| Q |
59 |
gtagcatgcatgcatgcaaaaattagaaaatgttgaaacagaaaaaatgagctgagaatacgtgcatgatcctatgatgccggatacaatgattacataa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2230947 |
gtagcatgcatgcatgcaaaaattagaaaatgttgaaacagaaaaaatgagctcagaatacatgcatgatcc---------ggatacaatgattacataa |
2230857 |
T |
 |
| Q |
159 |
tgtctacctttgcaattagattttggtttgttctcatcaagattttggtgtcaaaaataacccttttacaacaaaaatgttattggaacacacttgacac |
258 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2230856 |
tgtctacctttgcaattagattttagtttgttctcatcaagattttggtgtcaaaaataacccttttacaacaaaaatgttattggaacacacttgacac |
2230757 |
T |
 |
| Q |
259 |
aaatatggtaacagctacactcatgaccatatttatattttttggtca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2230756 |
aaatatggtaacagctacactcatgaccatatttatattttttggtca |
2230709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University