View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_38 (Length: 343)
Name: NF2926_low_38
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 9 - 199
Target Start/End: Complemental strand, 46435233 - 46435043
Alignment:
| Q |
9 |
agcagagaccaaagaccgagtcgacaactcgaagaatcgagtccctgaccgagtcatcacacctaggtcactagacttcaatgcgtggtatctcgatatc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46435233 |
agcagagaccaaagaccgagtcgacaactcgaagaatcgagtccctgaccgagtcatcacacctaggtcacaagacttcaatgcgtggtatctcgatatc |
46435134 |
T |
|
| Q |
109 |
atagccaatgctgaattagccgattacggtccggttcgcggtacaatggttattcgtccctatggttacgccatttgggaagccattcagg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46435133 |
atagccaatgctgaattagccgattacggtccggttcgcggtacaatggttattcgtccctatggttacgcaatttgggaagccattcagg |
46435043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 319
Target Start/End: Complemental strand, 46434952 - 46434923
Alignment:
| Q |
290 |
aatgtgaaattcaaggagactggacatagt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46434952 |
aatgtgaaattcaaggagactggacatagt |
46434923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University